sudo.bio
Install MCP

Give your agent the tools behind this page. Needs bio on your machine — how to get it.

Cursorone click 
claude mcp add sudo.bio -- bio mcp
{
  "mcpServers": {
    "sudo.bio": {
      "command": "bio",
      "args": [
        "mcp"
      ]
    }
  }
}

← avgfp-brightness-screen

a866539b L16P:I45F:Y104D:N168I: log10 fluorescence 1.301 (robust z -2.15) — no change

walkthrough · branch plate-1-f1 · 2026-10-29 18:40 UTC

Observation failure

instrumentBMG CLARIOstar
capture source pasted_export pasted from the instrument's own export

Raw artifact, stored verbatim:

{"is_hit": false, "label": "L16P:I45F:Y104D:N168I", "measurement": "log10 fluorescence", "parent": "15efe7753aa99b60a8d8afaabbbfce7a42d8d54d", "robust_z": -2.1475237084845555, "screen": "plate-1", "value": 1.3010299268, "well": "F1"}

Strain fields below are inherited from the parent record — an observation reports on a strain, it does not change it.

Record

genotype
marker
phenotype
protocol
strain
full shaa866539b4bca2b44b9a7756cb213307f799a94a4

Download record.json · Download barcode.fasta

Barcode (format v0)

GGTCTCAGGGACGCGCCATGCGTGGTGAGACC

32 nt · structure: 7 nt anchor + 16 nt payload (first 8 hex chars of the commit sha at 2 bits/base) + 2 nt checksum + 7 nt anchor. Integrate at a neutral genomic site; any single-base read error in the core is detected by the checksum.

GC 69% max homopolymer 3 no restriction sites in core

Constraint warnings are informational in v0 — the commit id is fixed by content, so a failing barcode flags a candidate for re-encoding strategies (a v1 concern).

Lineage (this commit and its ancestry)

→ a866539b L16P:I45F:Y104D:N168I: log10 fluorescence 1.301 (robust z -2.15) — no change — walkthrough, 2026-10-29 18:40 UTC
↑ 15efe775 plate 1 of the avGFP screen — walkthrough, 2026-10-29 18:40 UTC