sudo.bio
Install MCP

Give your agent the tools behind this page. Needs bio on your machine — how to get it.

Cursorone click 
claude mcp add sudo.bio -- bio mcp
{
  "mcpServers": {
    "sudo.bio": {
      "command": "bio",
      "args": [
        "mcp"
      ]
    }
  }
}

← lacz-knockout-k12

7c7082e1 lacZ knockout via lambda-Red recombineering

t.meany · branch main · 2026-10-29 09:40 UTC

Record

genotypedlacZ::kanR
markerkanR
phenotypeLac-, Kan resistant
protocolDatsenko-Wanner, pKD46, 42C induction
strainMG1655 dlacZ
full sha7c7082e18424b9c4cd27776fabc2505d8020e3dd

Download record.json · Download barcode.fasta

Barcode (format v0)

GGTCTCACTTACTAAGAAGTGACATTGAGACC

32 nt · structure: 7 nt anchor + 16 nt payload (first 8 hex chars of the commit sha at 2 bits/base) + 2 nt checksum + 7 nt anchor. Integrate at a neutral genomic site; any single-base read error in the core is detected by the checksum.

GC 44% max homopolymer 2 no restriction sites in core

Lineage (this commit and its ancestry)

→ 7c7082e1 lacZ knockout via lambda-Red recombineering — t.meany, 2026-10-29 09:40 UTC
↑ 2e125e25 Initial record: wild-type base strain — l.hobbs, 2026-10-29 09:40 UTC