sudo.bio
Install MCP

Give your agent the tools behind this page. Needs bio on your machine — how to get it.

Cursorone click 
claude mcp add sudo.bio -- bio mcp
{
  "mcpServers": {
    "sudo.bio": {
      "command": "bio",
      "args": [
        "mcp"
      ]
    }
  }
}

← pkd46-helper

3d197e8f Import pKD46 from GenBank AY048746

ncbi-import · branch main · 2026-10-29 19:23 UTC

Construct circular sequence changed here

pKD46 · 6,329 bp · 46.4% GC · 11 features
Red recombinase plasmid pKD46, complete sequence...

Map of pKD46, 6329 base pairs

All 11 features
featurekindspanlengthstrand
araC CDS 11..889 879 bp ←
Pc misc_feature 1,040..1,068 29 bp ←
ParaB misc_feature 1,165..1,192 28 bp →
gam CDS 1,244..1,660 417 bp →
bet CDS 1,666..2,451 786 bp →
exonuclease CDS 2,448..3,128 681 bp →
tL3 misc_feature 3,118..3,387 270 bp →
orf60a CDS 3,125..3,307 183 bp →
repA101 CDS 3,496..4,446 951 bp ←
oriR101 rep_origin 4,450..5,190 741 bp →
beta-lactamase CDS 5,338..6,198 861 bp ←

Download sequence.gb · Open map.svg

Record

genotypearaC, gam-bet-exo under ParaB, repA101ts, bla
markerbla (AmpR)
phenotypeAmpR, temperature-sensitive replicon, arabinose-inducible
protocolDatsenko & Wanner 2000, PNAS 97:6640
strainpKD46
full sha3d197e8f0ee11fcdf2f3c28709416b5afdc32aa0

Download record.json · Download barcode.fasta

Barcode (format v0)

GGTCTCAATTCACGCCTTGGATTCGTGAGACC

32 nt · structure: 7 nt anchor + 16 nt payload (first 8 hex chars of the commit sha at 2 bits/base) + 2 nt checksum + 7 nt anchor. Integrate at a neutral genomic site; any single-base read error in the core is detected by the checksum.

GC 53% max homopolymer 2 no restriction sites in core

Lineage (this commit and its ancestry)

→ 3d197e8f Import pKD46 from GenBank AY048746 — ncbi-import, 2026-10-29 19:23 UTC