sudo.bio
Install MCP

Give your agent the tools behind this page. Needs bio on your machine — how to get it.

Cursorone click 
claude mcp add sudo.bio -- bio mcp
{
  "mcpServers": {
    "sudo.bio": {
      "command": "bio",
      "args": [
        "mcp"
      ]
    }
  }
}

← lacz-knockout-k12

18fa6469 FLP excision of kanR cassette

t.meany · branch marker-cured · 2026-10-29 09:40 UTC

Record

genotypedlacZ (scar)
markernone
phenotypeLac-, Kan sensitive
protocolpCP20 at 30C, cured at 43C
strainMG1655 dlacZ cured
full sha18fa646982a3c9e8fe3f805c0b80028d5e450451

Download record.json · Download barcode.fasta

Barcode (format v0)

GGTCTCAACGATTGGCGCACGGCGTTGAGACC

32 nt · structure: 7 nt anchor + 16 nt payload (first 8 hex chars of the commit sha at 2 bits/base) + 2 nt checksum + 7 nt anchor. Integrate at a neutral genomic site; any single-base read error in the core is detected by the checksum.

GC 62% max homopolymer 2 no restriction sites in core

Constraint warnings are informational in v0 — the commit id is fixed by content, so a failing barcode flags a candidate for re-encoding strategies (a v1 concern).

Lineage (this commit and its ancestry)

→ 18fa6469 FLP excision of kanR cassette — t.meany, 2026-10-29 09:40 UTC
↑ 7c7082e1 lacZ knockout via lambda-Red recombineering — t.meany, 2026-10-29 09:40 UTC
↑ 2e125e25 Initial record: wild-type base strain — l.hobbs, 2026-10-29 09:40 UTC