583864a1 qPCR: 3 of 8 clones positive
t.meany · branch main · 2026-10-29 11:08 UTC
Observation success
| instrument | QuantStudio 5 |
|---|---|
| capture source |
pasted_export
pasted from the instrument's own export
|
Raw artifact, stored verbatim:
Well,Ct A1,22.4 A2,Undetermined
Strain fields below are inherited from the parent record — an observation reports on a strain, it does not change it.
Record
| genotype | dlacZ::kanR, attB::P_tet-sfGFP |
|---|---|
| marker | kanR |
| phenotype | Lac-, fluorescent under aTc |
| protocol | CRIM integration, pINT-ts helper |
| strain | MG1655 dlacZ GFP |
| full sha | 583864a1056662b36749ff8f89a20cf5a85f34cd |
Barcode (format v0)
GGTCTCACCGAATGACGCAGGACTCTGAGACC32 nt · structure: 7 nt anchor + 16 nt payload (first 8 hex chars of the commit sha at 2 bits/base) + 2 nt checksum + 7 nt anchor. Integrate at a neutral genomic site; any single-base read error in the core is detected by the checksum.
GC 59% max homopolymer 2 no restriction sites in core
Lineage (this commit and its ancestry)
→
583864a1
qPCR: 3 of 8 clones positive — t.meany, 2026-10-29 11:08 UTC↑
c003c49e
P_tet-sfGFP integrated at attB neutral site — l.hobbs, 2026-10-29 09:40 UTC↑
7c7082e1
lacZ knockout via lambda-Red recombineering — t.meany, 2026-10-29 09:40 UTC↑
2e125e25
Initial record: wild-type base strain — l.hobbs, 2026-10-29 09:40 UTC